Browsing by Author "Feleni, Usisipho"

Now showing 1 - 6 of 6
  • Thumbnail Image
    Item
    Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
    (Hindawi, 2021) Sifuba, Sabelo; Willenberg, Shane; Feleni, Usisipho
    In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural and electronic properties of optimized electrode materials, a systematic study based on a combination of structural and spectroscopic techniques was conducted. The phosphor-olivine LiFe0.5Mn0.5PO4 was synthesized via a simple microwave synthesis using LiFePO4 and LiMnPO4 as precursors. Cyclic voltammetry was used to evaluate the electrochemical parameters (electron transfer and ionic diffusivity) of the LiFe0.5Mn0.5PO4 redox couples. The redox potentials show two separate distinct redox peaks that correspond to Mn2+/Mn3+ (4.1 V vs Li/Li+) and Fe2+/Fe3+ (3.5 V vs Li/Li+) due to interaction arrangement of Fe-O-Mn in the olivine lattice. The electrochemical impedance spectroscopy (EIS) results showed LiFe0.5Mn0.5PO4-MWCNTs have high conductivity with reduced charge resistance. This result demonstrates that MWCNTs stimulate faster electron transfer and stability for the LiFe0.5Mn0.5PO4 framework, which demonstrates to be favorable as a host material for Li+ ions.
  • Thumbnail Image
    Item
    Electrochemically enhanced ferric lithium manganese phosphate / multi-walled carbon nanotube, as a possible composite cathode material for lithium ion battery
    (University of the Western Cape, 2019) Sifuba, Sabelo; Ross, Natasha; Iwuoha, Emmanuel; Feleni, Usisipho
    Lithium iron manganese phosphate (LiFe0.5Mn0.5PO4), is a promising, low cost and high energy density (700 Wh/kg) cathode material with high theoretical capacity and high operating voltage of 4.1 V vs. Li/Li+, which falls within the electrochemical stability window of conventional electrolyte solutions. However, a key problem prohibiting it from large scale commercialization is its severe capacity fading during cycling. The improvement of its electrochemical cycling stability is greatly attributed to the suppression of Jahn-Teller distortion at the surface of the LiFe0.5Mn0.5PO4 particles. Nanostructured materials offered advantages of a large surface to volume ratio, efficient electron conducting pathways and facile strain relaxation. The LiFe0.5Mn0.5PO4 nanoparticles were synthesized via a simple-facile microwave method followed by coating with multi-walled carbon nanotubes (MWCNTs) nanoparticles to enhance electrical and thermal conductivity. The pristine LiFe0.5Mn0.5PO4 and LiFe0.5Mn0.5PO4-MWCNTs composite were examined using a combination of spectroscopic and microscopic techniques along with electrochemical techniques such as cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). Microscopic results revealed that the LiFe0.5Mn0.5PO4-MWCNTs composite contains well crystallized particles and regular morphological structures with narrow size distributions. The composite cathode exhibits better reversibility and kinetics than the pristine LiFe0.5Mn0.5PO4 due to the presence of the conductive additives in the LiFe0.5Mn0.5PO4-MWCNTs composite. For the composite cathode, D = 2.0 x 10-9 cm2/s while for pristine LiFe0.5Mn0.5PO4 D = 4.81 x 10-10 cm2/s. The charge capacity and the discharge capacity for LiFe0.5Mn0.5PO4-MWCNTs composite were 259.9 mAh/g and 177.6 mAh/g, respectively, at 0.01 V/s. The corresponding values for pristine LiFe0.5Mn0.5PO4 were 115 mAh/g and 44.75 mAh/g, respectively. This was corroborated by EIS measurements. LiFe0.5Mn0.5PO4-MWCNTs composite showed to have better conductivity which corresponded to faster electron transfer and therefore better electrochemical performance than pristine LiFe0.5Mn0.5PO4. The composite cathode material (LiFe0.5Mn0.5PO4-MWCNTs) with improved electronic conductivity holds great promise for enhancing electrochemical performances and the suppression of the reductive decomposition of the electrolyte solution on the LiFe0.5Mn0.5PO4 surface. This study proposes an easy to scale-up and cost-effective technique for producing novel high-performance nanostructured LiFe0.5Mn0.5PO4 nano-powder cathode material.
  • Thumbnail Image
    Item
    Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
    (MPDI, 2021) Bilibana, Mawethu Pascoe; Feleni, Usisipho; Williams, Avril Rae
    This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC3 0 ). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)- poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0 ) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0 ) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0 . Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.
  • Thumbnail Image
    Item
    Palladium telluride quantum dots biosensor for the determination of indinavir drug
    (2013) Feleni, Usisipho; Iwuoha, Emmanuel
    Indinavir is a potent and well tolerated protease inhibitor drug used as a component of the highly active antiretroviral therapy (HAART) of HIV/AIDS, which results in pharmacokinetics that may be favourable or adverse. These drugs work by maintaining a plasma concentration that is sufficient to inhibit viral replication and thereby suppressing a patient’s viral load. A number of antiretroviral drugs, including indinavir, undergo metabolism that is catalysed by cytochrome P450-3A4 enzyme found in the human liver microsomes. The rate of drug metabolism influences a patient’s response to treatment as well as drug interactions that may lead to life-threatening toxic conditions, such as haemolytic anaemia, kidney failure and liver problems. Therapeutic drug monitoring (TDM) during HIV/AIDS treatment has been suggested to have a potential to reduce drug toxicity and optimise individual therapy. A fast and reliable detection technique, such as biosensing, is therefore necessary for the determination of a patient’s metabolic profile for indinavir and for appropriate dosing of the drugs. In this study biosensors developed for the determination of ARV drugs comprised of cysteamine self-assembled on a gold electrode, on which was attached 3-mercaptopropionic acid-capped palladium telluride (3-MPA-PdTe) or thioglycolic acid-capped palladium telluride (TGA-PdTe) quantum dots that are cross-linked to cytochrome P450-3A4 (CYP3A4) in the presence of 1-ethyl-3(3-dimethylaminopropyl) carbodiimide hydrochloride and N-hydroxysuccinimide. The quantum dots were synthesized in the presence of capping agents (3-MPA or TGA) to improve their stability, solubility and biocompatibility. The capping of PdTe quantum dots with TGA or 3-MPA was confirmed by FTIR, where the SH group absorption band disappeared from the spectra of 3-MPA-PdTe and TGA-PdTe. The particle size of the quantum dots (< 5 nm) was estimated from high resolution transmission electron microscopy (HRTEM) measurements. Optical properties of the materials were confirmed by UV-Vis spectrophotometry which produced absorption iii bands at ~320 nm that corresponded to energy band gap values of 3 eV (3.87 eV) for TGAPdTe (3-MPA-PdTe) quantum dots. The electrocatalytic properties of the quantum dots biosensor systems were studied by cyclic voltammetry (CV) for which the characteristic reduction peak at 0.75 V was used to detect the response of the biosensor to indinavir. Results for indinavir biosensor constructed with 3-MPA-SnSe quantum dots are also reported in this thesis. The three biosensors systems were very sensitive towards indinavir; and gave low limits of detection (LOD) values of 3.22, 4.3 and 6.2 ng/mL for 3-MPA-SnSe, 3-MPA-PdTe and TGA-PdTe quantum dots biosensors, respectively. The LOD values are within the ‘maximum plasma concentration’ (Cmax) value of indinavir (5 - 15 ng/mL) normally observed 8 h after drug intake.
  • Thumbnail Image
    Item
    Quantum dot-sensitised estrogen receptor-α-based biosensor for 17β-estradiol
    (MDPI, 2023) Jijana, Abongile N.; Feleni, Usisipho; Ndangili, Peter M.; Bilibana, Mawethu; Ajayi, Rachel F
    : 17β-estradiol (E2) is an important natural female hormone that is also classified as an estrogenic endocrine-disrupting compound (e-EDC). It is, however, known to cause more damaging health effects compared to other e-EDCs. Environmental water systems are commonly contaminated with E2 that originates from domestic effluents. The determination of the level of E2 is thus very crucial in both wastewater treatment and in the aspect of environmental pollution management. In this work, an inherent and strong affinity of the estrogen receptor-α (ER-α) for E2 was used as a basis for the development of a biosensor that was highly selective towards E2 determination. A gold disk electrode (AuE) was functionalised with a 3-mercaptopropionic acid-capped tin selenide (SnSe-3MPA) quantum dot to produce a SnSe-3MPA/AuE electroactive sensor platform. The ER-α-based biosensor (ER-α/SnSe-3MPA/AuE) for E2 was produced by the amide chemistry of carboxyl functional groups of SnSe-3MPA quantum dots and the primary amines of ER-α. The ER-α/SnSe-3MPA/AuE receptorbased biosensor exhibited a formal potential (E0 0 ) value of 217 ± 12 mV, assigned as the redox potential for monitoring the E2 response using square-wave voltammetry (SWV). The response parameters of the receptor-based biosensor for E2 include a dynamic linear range (DLR) value of 1.0–8.0 nM (R2 = 0.99), a limit of detection (LOD) value of 1.69 nM (S/N = 3), and a sensitivity of 0.04 µA/nM. The biosensor exhibited high selectivity for E2 and good recoveries for E2 determination in milk samples
  • Thumbnail Image
    Item
    Quantum dots-amplified electrochemical cytochrome P450 phenotype sensor for tamoxifen, a breast cancer drug
    (University of the Western Cape, 2017) Feleni, Usisipho; Iwuoha, Emmanuel I.
    Breast cancer is regarded as the most common cancer in South Africa and its rate of occurrence is increasing. About one in every 31 South African women are at the risk of developing breast cancer and early diagnosis and treatment guarantee 90% survival rate. Tamoxifen is the drugs of choice for the treatment of all stages of breast cancer. The drug binds with estrogen receptor (ER) to minimize the transcription of estrogen dependent genes. However, nearly 50% of ER-positive breast cancer patients either become resistant or fail to respond to tamoxifen resulting in a serious clinical challenge in breast cancer management. The Grand Health Challenges of South Africa includes the development of cost effective diagnostic systems suitable for early detection of diseases and drug resistivity for timely invention and better patient management.