Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
dc.contributor.author | Bilibana, Mawethu Pascoe | |
dc.contributor.author | Feleni, Usisipho | |
dc.contributor.author | Williams, Avril Rae | |
dc.date.accessioned | 2022-06-14T08:18:42Z | |
dc.date.available | 2022-06-14T08:18:42Z | |
dc.date.issued | 2021 | |
dc.description.abstract | This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC3 0 ). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)- poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0 ) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0 ) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0 . Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR. | en_US |
dc.identifier.citation | Bilibana, M. P. et al. (2021). Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite. Processes, 9(1), 179. https://doi.org/10.3390/pr9010179 | en_US |
dc.identifier.issn | 2227-9717 | |
dc.identifier.uri | https://doi.org/10.3390/pr9010179 | |
dc.identifier.uri | http://hdl.handle.net/10566/7518 | |
dc.language.iso | en | en_US |
dc.publisher | MPDI | en_US |
dc.subject | Electrochemical aptasensor | en_US |
dc.subject | Silver nanoparticles | en_US |
dc.subject | Chemistry | en_US |
dc.subject | Electrochromic devices | en_US |
dc.title | Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite | en_US |
dc.type | Article | en_US |
Files
Original bundle
1 - 1 of 1
Loading...
- Name:
- bilibana_impedimetric microcystin-lr aptasensor_2021.pdf
- Size:
- 5.01 MB
- Format:
- Adobe Portable Document Format
- Description:
License bundle
1 - 1 of 1
No Thumbnail Available
- Name:
- license.txt
- Size:
- 1.71 KB
- Format:
- Item-specific license agreed upon to submission
- Description: