Browsing by Author "Williams, Avril Rae"

Now showing 1 - 1 of 1
  • Thumbnail Image
    Item
    Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
    (MPDI, 2021) Bilibana, Mawethu Pascoe; Feleni, Usisipho; Williams, Avril Rae
    This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC3 0 ). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)- poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0 ) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0 ) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0 . Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.