Repository logo
  • English
  • Català
  • Čeština
  • Deutsch
  • Español
  • Français
  • Gàidhlig
  • Italiano
  • Latviešu
  • Magyar
  • Nederlands
  • Polski
  • Português
  • Português do Brasil
  • Srpski (lat)
  • Suomi
  • Svenska
  • Türkçe
  • Tiếng Việt
  • Қазақ
  • বাংলা
  • हिंदी
  • Ελληνικά
  • Српски
  • Yкраї́нська
  • Log In
    New user? Click here to register. Have you forgotten your password?
Repository logo
  • Communities & Collections
  • Browse UWCScholar
  • English
  • Català
  • Čeština
  • Deutsch
  • Español
  • Français
  • Gàidhlig
  • Italiano
  • Latviešu
  • Magyar
  • Nederlands
  • Polski
  • Português
  • Português do Brasil
  • Srpski (lat)
  • Suomi
  • Svenska
  • Türkçe
  • Tiếng Việt
  • Қазақ
  • বাংলা
  • हिंदी
  • Ελληνικά
  • Српски
  • Yкраї́нська
  • Log In
    New user? Click here to register. Have you forgotten your password?
  1. Home
  2. Browse by Author

Browsing by Author "Bilibana, Mawethu Pascoe"

Now showing 1 - 2 of 2
Results Per Page
Sort Options
  • Loading...
    Thumbnail Image
    Item
    Construction of an enzyme-free electrochemical sensor based on Ag-Fe2O3/POM/RGO novel nanocomposite for hydrogen peroxide detection
    (University of the Western Cape, 2018) Nqakala, Noniko Civilized; Ross, Natasha; Bilibana, Mawethu Pascoe
    The motivation to determine H2O2 lies in the fact that this chemical species plays a crucial role in diverse fields of practise such as cosmetic, food, diagnostic, pharmaceutical, clinical and environmental protection industries. Several methods such as chromatography, colorimetry, titrimetry and spectrophotometry have been developed for its detection. However, these methods are known to manifest underlying disadvantages such as high cost, time consuming, instability and complicated immobilization procedures. In this present study an enzyme-less electrochemical sensor based on Ag-Fe2O3/POM/RGO nanocomposite (POM stands for polyoxometalate and RGO stands for reduced graphene oxide) was successfully synthesised via a hydrothermal method and a photochemical reduction method for the detection of hydrogen peroxide (H2O2).
  • Loading...
    Thumbnail Image
    Item
    Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
    (MPDI, 2021) Bilibana, Mawethu Pascoe; Feleni, Usisipho; Williams, Avril Rae
    This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC3 0 ). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)- poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0 ) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0 ) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0 . Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.

DSpace software copyright © 2002-2026 LYRASIS

  • Cookie settings
  • Privacy policy
  • End User Agreement
  • Send Feedback